DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_067994c
Line Availability available from NASC (N656614) and ABRC (SALK_067994c)
Confirmed for Hit At1g16460
Parent of DUPLO pair 2459
Parent of pair(s) none

Gene hit At1g16460

 
Sequence (A. th genome BLAST matches underlined)
ACAGTCCGATTGCGGCCTCATGTGGAACCGGTGTAACAGCTTGTATTTTGGCATTGGTAA
CTAAATGATGATCTAGAATT
GenBank Accession ED596426 [GenBank]
Graphic View Graphic view of gene At1g16460
Predicted Position of Insertion Chr1:5620093 - go to primer design
BLAST e Value 1e-38
Hit Clone Code (BAC ID) F3O9
Hit Gene Code At1g16460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation rhodanese homologue 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37