DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_068206
Line Availability available from NASC (N568206) and ABRC (SALK_068206)
Confirmed for Hit At1g72830
Parent of DUPLO pair 7982
Parent of pair(s) none

Gene hit At1g72830

 
Sequence (A. th genome BLAST matches underlined)
ATGCGTTTGTTTAAAATATAAACCAAAATTTGGTAACTACCTTACGGGCTCTGATTAGTT
TGTTTTGAGCCTCAAGCT
GenBank Accession CC179401 [GenBank]
Graphic View Graphic view of gene At1g72830
Predicted Position of Insertion Chr1:27406133 - go to primer design
BLAST e Value 1e-37
Hit Clone Code (BAC ID) F28P22
Hit Gene Code At1g72830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit A3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37