DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_068236
Line Availability available from NASC (N568236) and ABRC (SALK_068236)
Confirmed for Hit At1g53770
Parent of DUPLO pair none
Parent of pair(s) 2104, 88102

Gene hit At1g53770

 
Sequence (A. th genome BLAST matches underlined)
GTACAAGTGATATAAACTCATAATGCTCATACTTATTCATAAATGATAACTTGGTCAATG
GAATT
GenBank Accession BH848440 [GenBank]
Graphic View Graphic view of gene At1g53770
Predicted Position of Insertion Chr1:20072119 - go to primer design
BLAST e Value 7e-30
Hit Clone Code (BAC ID) F22G10
Hit Gene Code At1g53770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-fucosyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37