DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_069046c
Line Availability available from NASC (N672636) and ABRC (SALK_069046c)
Confirmed for Hit At3g04030
Parent of DUPLO pair 2529
Parent of pair(s) none

Gene hit At3g04030

 
Sequence (A. th genome BLAST matches underlined) 
AATGCTTTTATATTTCTACATACTACAAACTTATCCTCTAAACACTGACTGATAATTCTA
AGTGCTTTATGAACTGCAAGAATCTTTAACGTGTTTAATTGGAGTAAAGAACAGTGTTGT
AGAAATATGATACCTCAAGTTGCTCATGAAGCCTTCTTTGGACCTCTATTTGCATTTGCA
GTGCTTCACCTATTGGTGAATT
GenBank Accession BH848941 [GenBank]
Graphic View Graphic view of gene At3g04030
Predicted Position of Insertion Chr3:1043639 - go to primer design
BLAST e Value 1e-111
Hit Clone Code (BAC ID) T11I18
Hit Gene Code At3g04030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeodomain-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37