DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_069400c
Line Availability available from NASC (N666352) and ABRC (SALK_069400c)
Confirmed for Hit At1g26190
Parent of DUPLO pair 2525
Parent of pair(s) none

Gene hit At1g26190

 
Sequence (A. th genome BLAST matches underlined) 
GATAGAAATCCGGTCACTTTTCAAACCTTCAAGATGTAAGTCGGGCTCTGAAAACCAGTG
AAGGGGTTGAATTATTAATGGGATTTTGATTTGAGCAGTCTGGAGATCTGGCTCAATGAA
AGCT
GenBank Accession BH849222 [GenBank]
Graphic View Graphic view of gene At1g26190
Predicted Position of Insertion Chr1:9059267 - go to primer design
BLAST e Value 5e-54
Hit Clone Code (BAC ID) F28B23
Hit Gene Code At1g26190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphoribulokinase / Uridine kinase family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37