DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_070215
Line Availability available from NASC (N570215) and ABRC (SALK_070215)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g26190

 
Sequence (A. th genome BLAST matches underlined)
GACTTGTTCGAACGCTTGTGACTGAAGTTCCATTGGATAAT
GenBank Accession BH849732 [GenBank]
Graphic View Graphic view of gene At2g26190
Predicted Position of Insertion Chr2:11148051 - go to primer design
BLAST e Value 7e-16
Hit Clone Code (BAC ID) T1D16
Hit Gene Code At2g26190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation calmodulin-binding family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37