DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_071403c
Line Availability available from NASC (N662911) and ABRC (SALK_071403c)
Confirmed for Hit At3g18035
Parent of DUPLO pair 1151
Parent of pair(s) none

Gene hit At3g18035

 
Sequence (A. th genome BLAST matches underlined) 
CTCGATTTTGCAATATCTGACGTTTACTGTGCATGATTGTTCACTGCTCCGCCGTCAATT
TAGATTGATAAAGTTTGATACTTGTGTTGCAATCATTGTGGAATT
GenBank Accession BH850517 [GenBank]
Graphic View Graphic view of gene At3g18035
Predicted Position of Insertion Chr3:6170344 - go to primer design
BLAST e Value 2e-53
Hit Clone Code (BAC ID) MBG14
Hit Gene Code At3g18035 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation winged-helix DNA-binding transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH850517 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37