DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_071698c
Line Availability available from NASC (N684897) and ABRC (SALK_071698c)
Confirmed for Hit At1g55320
Parent of DUPLO pair 12323
Parent of pair(s) none

Gene hit At1g55320

 
Sequence (A. th genome BLAST matches underlined)
TACTTCATGATGCTGAAGTTACAGTTCATGGTACTGTTCCAAGCT
GenBank Accession BH850690 [GenBank]
Graphic View Graphic view of gene At1g55320
Predicted Position of Insertion Chr1:20635357 - go to primer design
BLAST e Value 5e-11
Hit Clone Code (BAC ID) F7A10
Hit Gene Code At1g55320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation acyl-activating enzyme 18
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37