DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_072339c
Line Availability available from NASC (N659967) and ABRC (SALK_072339c)
Confirmed for Hit At3g58050
Parent of DUPLO pair 935
Parent of pair(s) none

Gene hit At3g58050

 
Sequence (A. th genome BLAST matches underlined) 
GATTCACTACATTCAAAACAAGTTTGGGAGCCCATGGAGCCAAAGAAGTACCCACGAAGC
AACTCGTACTCTGAAGTAACAGTTAGATGTTCAACATTTAAGGCTGAAGAGATAGAAGAC
GCTATCGTTGCTGAGAATT
GenBank Accession BH851048 [GenBank]
Graphic View Graphic view of gene At3g58050
Predicted Position of Insertion Chr3:21495894 - go to primer design
BLAST e Value 1e-73
Hit Clone Code (BAC ID) T10K17
Hit Gene Code At3g58050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37