DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_073422
Line Availability available from NASC (N573422) and ABRC (SALK_073422)
Confirmed for Hit At1g30810
Parent of DUPLO pair 2811
Parent of pair(s) none

Gene hit At1g30810

 
Sequence (A. th genome BLAST matches underlined) 
GCCTTGTTCTTCTTCATTAAAAAGCTATTCATGATGTTAACTCTTACACAACTTAACGCT
TCTCTACAGGCCATTGAAGCTCTTGACCCAAACCATCGACTAGTTGAGTACTGGAACCAC
AAGAACCAAACTTCATCAGACTCAAAAGGTAGCCCGGTCCGTCGACCACGCTTGCCCTAT
GATGAGTCGTAAAACTTTTCGGAGTAGATTGCATACNNCNGANACNNCNNTGACCTATCT
TTTAGATAGATAGAGAGAAGAAATTTCTTTCTGA
GenBank Accession BH851725 [GenBank]
Graphic View Graphic view of gene At1g30810
Predicted Position of Insertion Chr1:10938357 - go to primer design
BLAST e Value 1e-78
Hit Clone Code (BAC ID) T17H7
Hit Gene Code At1g30810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37