DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_074937
Line Availability available from NASC (N574937) and ABRC (SALK_074937)
Confirmed for Hit At3g53930
Parent of DUPLO pair 2282
Parent of pair(s) none

Gene hit At3g53930

 
Sequence (A. th genome BLAST matches underlined) 
GAAAATGACCCCGACCCCATTTGTCTACCCACCGCATAATCGCCGATAACCCTTCCGCTT
CTCCCCGCCGCCGCCACCAACGACGACTGAGCCATTTTACCTCCGACAAAGGAGTAAAAA
TACAACTCCGGAGATCCGAAATTGAGCTGATGATGACTAAAAGTTTCAGAAATTGATTGA
ACGATCGATTTGGAGTTGAAAATTAAAGGATTGAATTTGGGAGGCGGATTCCTATAAGAT
GATAGAGAAGATAGAAAGAAAGA
GenBank Accession BZ593624 [GenBank]
Graphic View Graphic view of gene At3g53930
Predicted Position of Insertion Chr3:19966635 - go to primer design
BLAST e Value 1e-128
Hit Clone Code (BAC ID) F5K20
Hit Gene Code At3g53930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37