DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_075267c
Line Availability available from NASC (N680500) and ABRC (SALK_075267c)
Confirmed for Hit At1g55760
Parent of DUPLO pair 230
Parent of pair(s) none

Gene hit At1g55760

 
Sequence (A. th genome BLAST matches underlined)
CTTTCTTAAATTCACTATTCTATGCAACGTTGAATCAAGATGCTTGGTGAAACATGTGCG
CTGAACTGATAGATCACCTTAATT
GenBank Accession CC455222 [GenBank]
Graphic View Graphic view of gene At1g55760
Predicted Position of Insertion Chr1:20847809 - go to primer design
BLAST e Value 1e-19
Hit Clone Code (BAC ID) F20N2
Hit Gene Code At1g55760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BTB/POZ domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37