DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_075996
Line Availability available from NASC (N575996) and ABRC (SALK_075996)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g37130

 
Sequence (A. th genome BLAST matches underlined) 
CCGTGGTGCATTAGACGGGTAATAGGCGCCTCGGAGATGAAGGGATGTT
GenBank Accession BZ664533 [GenBank]
Graphic View Graphic view of gene At1g37130
Predicted Position of Insertion Chr1:14159014 - go to primer design
BLAST e Value 6e-11
Hit Clone Code (BAC ID) F28L22
Hit Gene Code At1g37130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nitrate reductase 2
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37