DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_076027c
Line Availability available from NASC (N669850) and ABRC (SALK_076027c)
Confirmed for Hit At3g50900
Parent of DUPLO pair none
Parent of pair(s) 2237

Gene hit At3g50900

 
Sequence (A. th genome BLAST matches underlined)
GTTTAGCAACGGCGAAACCAGAGTTTGCTAGGTATATGGAGTATTGTGAGAGAAGGAGGT

GenBank Accession BH853108 [GenBank]
Graphic View Graphic view of gene At3g50900
Predicted Position of Insertion Chr3:18918363 - go to primer design
BLAST e Value 3e-22
Hit Clone Code (BAC ID) F18B3
Hit Gene Code At3g50900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37