DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_076686c
Line Availability available from NASC (N653305) and ABRC (SALK_076686c)
Confirmed for Hit At3g55840
Parent of DUPLO pair 912
Parent of pair(s) none

Gene hit At3g55840

 
Sequence (A. th genome BLAST matches underlined) 
TTTGGAAACGTCGATTTGATTTGTAACTGTTTCTTCACCTTCAAGAAATCTTCAGGATCC
ATAAGAATGTGTAAATCTTCAATCTCTGATAGAAGCT
GenBank Accession BH857140 [GenBank]
Graphic View Graphic view of gene At3g55840
Predicted Position of Insertion Chr3:20717930 - go to primer design
BLAST e Value 9e-49
Hit Clone Code (BAC ID) F27K19
Hit Gene Code At3g55840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Hs1pro-1 protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH857140 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37