DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_077395c |
| Line Availability | available from NASC (N657685) and ABRC (SALK_077395c) |
| Confirmed for Hit | At5g59770 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 1848 |
Gene hit At5g59770
| Sequence (A. th genome BLAST matches underlined) | GGTCAATATCAACAAGAAGAAATGAAAACAAGAATT |
| GenBank Accession | BH857014 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:24079908 - go to primer design |
| BLAST e Value | 6e-13 |
| Hit Clone Code (BAC ID) | MTH12 |
| Hit Gene Code | At5g59770 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Protein-tyrosine phosphatase-like, PTPLA |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BH857014 [GenBank] |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 