DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_077395c |
Line Availability | available from NASC (N657685) and ABRC (SALK_077395c) |
Confirmed for Hit | At5g59770 |
Parent of DUPLO pair | none |
Parent of pair(s) | 1848 |
Gene hit At5g59770
Sequence (A. th genome BLAST matches underlined) | GGTCAATATCAACAAGAAGAAATGAAAACAAGAATT |
GenBank Accession | BH857014 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:24079908 - go to primer design |
BLAST e Value | 6e-13 |
Hit Clone Code (BAC ID) | MTH12 |
Hit Gene Code | At5g59770 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Protein-tyrosine phosphatase-like, PTPLA |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | BH857014 [GenBank] |
Last Updated on Thursday, 10 June 2021 13:37 |