DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_078758
Line Availability available from NASC (N578758) and ABRC (SALK_078758)
Confirmed for Hit At3g19740
Parent of DUPLO pair 384
Parent of pair(s) none

Gene hit At3g19740

 
Sequence (A. th genome BLAST matches underlined)
CTGAAGTGTGTTGTTATTCCTCTAGTCGAAATAAATTGTATAGAATCTATGGTTCTTTCC
GAGTTACTATAGTATGT
GenBank Accession BH854112 [GenBank]
Graphic View Graphic view of gene At3g19740
Predicted Position of Insertion Chr3:6863171 - go to primer design
BLAST e Value 1e-34
Hit Clone Code (BAC ID) MMB12
Hit Gene Code At3g19740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37