DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_079139
Line Availability available from NASC (N579139) and ABRC (SALK_079139)
Confirmed for Hit At4g37690
Parent of DUPLO pair 11700
Parent of pair(s) none

Gene hit At4g37690

 
Sequence (A. th genome BLAST matches underlined)
GTTCAGAAAACCGGATCGTAATGGTAACCGGTTCACAATCCTCGCCGTGTAAAAACCCAA
TCGGAGACCATTTATTACTCCGATGCTTCAAAAACAAAGTCGATTACGCTCGAATCCATG
GTCACGACATCTTCTACAGCAATTCTCTTCTTCATCCGAAGATGAATT
GenBank Accession BH856797 [GenBank]
Graphic View Graphic view of gene At4g37690
Predicted Position of Insertion Chr4:17708610 - go to primer design
BLAST e Value 7e-91
Hit Clone Code (BAC ID) F19F18
Hit Gene Code At4g37690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactosyl transferase GMA12/MNN10 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH856797 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37