DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_079505c
Line Availability available from NASC (N670927) and ABRC (SALK_079505c)
Confirmed for Hit At5g29000
Parent of DUPLO pair 2782
Parent of pair(s) none

Gene hit At5g29000

 
Sequence (A. th genome BLAST matches underlined)
GCTGATTAACCGCTTCAACGACGGCCTCGTGAAGTTCTGGTGGCCCACGCATACGGTGAT
TAGGTGTTGC
GenBank Accession BH901468 [GenBank]
Graphic View Graphic view of gene At5g29000
Predicted Position of Insertion Chr5:11023393 - go to primer design
BLAST e Value 9e-14
Hit Clone Code (BAC ID) F3F24
Hit Gene Code At5g29000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeodomain-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37