DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_080688c
Line Availability available from NASC (N675909) and ABRC (SALK_080688c)
Confirmed for Hit At4g38950
Parent of DUPLO pair 2576
Parent of pair(s) none

Gene hit At4g38950

 
Sequence (A. th genome BLAST matches underlined)
TCTTTTCCTCTATTCTCCTGGAAACCTTGTCCCCACA
GenBank Accession BZ352484 [GenBank]
Graphic View Graphic view of gene At4g38950
Predicted Position of Insertion Chr4:18154855 - go to primer design
BLAST e Value 2e-06
Hit Clone Code (BAC ID) F19H22
Hit Gene Code At4g38950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP binding microtubule motor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37