DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_081200c
Line Availability available from NASC (N663104) and ABRC (SALK_081200c)
Confirmed for Hit At1g33230
Parent of DUPLO pair 11949
Parent of pair(s) none

Gene hit At1g33230

 
Sequence (A. th genome BLAST matches underlined)
ATGATCTTTGCTTGCTCTCACCAGTTCAAAGGAAACTTCAGACTTATTCTAAGTTCATAA
GCT
GenBank Accession BZ352595 [GenBank]
Graphic View Graphic view of gene At1g33230
Predicted Position of Insertion Chr1:12049239 - go to primer design
BLAST e Value 1e-28
Hit Clone Code (BAC ID) T9L6
Hit Gene Code At1g33230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TMPIT-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37