DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_083120
Line Availability available from NASC (N583120) and ABRC (SALK_083120)
Confirmed for Hit At2g36310
Parent of DUPLO pair 889
Parent of pair(s) none

Gene hit At2g36310

 
Sequence (A. th genome BLAST matches underlined)
TTCAGATCTTTGCTATGAGACAAAAAGCCAAACCGTTGTGACTTTACTTGAATT
GenBank Accession BZ594244 [GenBank]
Graphic View Graphic view of gene At2g36310
Predicted Position of Insertion Chr2:15225932 - go to primer design
BLAST e Value 3e-19
Hit Clone Code (BAC ID) F2H17
Hit Gene Code At2g36310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation uridine-ribohydrolase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BZ594244 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37