DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_083842c
Line Availability available from NASC (N653328) and ABRC (SALK_083842c)
Confirmed for Hit At5g20790
Parent of DUPLO pair 1268
Parent of pair(s) none

Gene hit At5g20790

 
Sequence (A. th genome BLAST matches underlined) 
GTTATGGGATGACAACAAAACACTAGTAACGGCGGCATGTGTCTAAATTAGAGAAGTTTC
ATATTTCGGAAAGTTTTTAAATCTTGAGAAGCTTTCTTGGTTTGAAGTGTTTTTCTTTTG
GenBank Accession BH855998 [GenBank]
Graphic View Graphic view of gene At5g20790
Predicted Position of Insertion Chr5:7040091 - go to primer design
BLAST e Value 5e-60
Hit Clone Code (BAC ID) T1M15
Hit Gene Code At5g20790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37