DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_084650
Line Availability available from NASC (N584650) and ABRC (SALK_084650)
Parent of DUPLO pair 12015
Parent of pair(s) none

Gene hit At1g55630

 
Sequence (A. th genome BLAST matches underlined)
GGGCTGAGCCGAGCTGGGAAGTTAGAAGCT
GenBank Accession BZ594657 [GenBank]
Graphic View Graphic view of gene At1g55630
Predicted Position of Insertion Chr1:20792245 - go to primer design
BLAST e Value 2e-09
Hit Clone Code (BAC ID) F20N2
Hit Gene Code At1g55630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37