DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_085482c
Line Availability available from NASC (N656708) and ABRC (SALK_085482c)
Confirmed for Hit At3g28920
Parent of DUPLO pair 11968
Parent of pair(s) none

Gene hit At3g28920

 
Sequence (A. th genome BLAST matches underlined)
CCGTCNAGCGCGTGACCACCAATCGCCGCCGCGAGGTTCTTGAGACATTCTTTGTAAGTG
ACTTTGTTG
GenBank Accession BZ594989 [GenBank]
Graphic View Graphic view of gene At3g28920
Predicted Position of Insertion Chr3:10941328 - go to primer design
BLAST e Value 5e-28
Hit Clone Code (BAC ID) MYI13
Hit Gene Code At3g28920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein 34
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37