DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_086345c
Line Availability available from NASC (N666620) and ABRC (SALK_086345c)
Confirmed for Hit At3g49320
Parent of DUPLO pair 1317
Parent of pair(s) none

Gene hit At3g49320

 
Sequence (A. th genome BLAST matches underlined)
AACATGGCTAAGAGAGAGAAGAAGAAGCTCTTCTACAACTAAACCCTCGACGTCGCGGGT
TTAAGCT
GenBank Accession BZ595241 [GenBank]
Graphic View Graphic view of gene At3g49320
Predicted Position of Insertion Chr3:18290625 - go to primer design
BLAST e Value 5e-31
Hit Clone Code (BAC ID) F2K15
Hit Gene Code At3g49320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Metal-dependent protein hydrolase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37