DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_086913c
Line Availability available from NASC (N658792) and ABRC (SALK_086913c)
Confirmed for Hit At3g62870
Parent of DUPLO pair 976
Parent of pair(s) none

Gene hit At3g62870

 
Sequence (A. th genome BLAST matches underlined)
CAAAAATACTCCATCGGCAAAAGCTGATTCAGCTAATTACCTTGATTGTCTCGAGGATGT
TGCAGAAC
GenBank Accession BZ762105 [GenBank]
Graphic View Graphic view of gene At3g62870
Predicted Position of Insertion Chr3:23243058 - go to primer design
BLAST e Value 1e-12
Hit Clone Code (BAC ID) F26K9
Hit Gene Code At3g62870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37