DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_087356
Line Availability available from NASC (N587356) and ABRC (SALK_087356)
Confirmed for Hit At4g17490
Parent of DUPLO pair 2474
Parent of pair(s) 1826

Gene hit At4g17490

 
Sequence (A. th genome BLAST matches underlined)
TATCGCCGTTATCTCCACACCCACCGTTTGGTTATCCACAATTGACCGTTGTTTGAATT
GenBank Accession BZ595544 [GenBank]
Graphic View Graphic view of gene At4g17490
Predicted Position of Insertion Chr4:9753028 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ethylene responsive element binding factor 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BZ595544 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37