DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_087377c
Line Availability available from NASC (N666635) and ABRC (SALK_087377c)
Confirmed for Hit At5g08100
Parent of DUPLO pair 2703
Parent of pair(s) none

Gene hit At5g08100

 
Sequence (A. th genome BLAST matches underlined)
TGGGATTAACAACAGAGGCCTTGCCGGAAACTGCTCCACCTCTTTTAGGATCTACCGCCC
ATAACGGAAGCTTCCATTTCATCACTGCCTTGAGCCCTTTATACTTATCCTTTACCCCCT
TTGAAGCCCGGGTGGGTCTCAAGTTCACCAACCTTACAAGTGGCGATCCTATCAAATTTG
GGACTAGTTAACTGATCACTAAAGAGAGTGACCTTTATAAATAAATCTAATATTGGTTCC
GAATT
GenBank Accession BH857780 [GenBank]
Graphic View Graphic view of gene At5g08100
Predicted Position of Insertion Chr5:2594063 - go to primer design
BLAST e Value 4e-53
Hit Clone Code (BAC ID) T22D6
Hit Gene Code At5g08100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37