DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_090068
Line Availability available from NASC (N590068) and ABRC (SALK_090068)
Confirmed for Hit At5g63630
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g63630

 
Sequence (A. th genome BLAST matches underlined)
TGTTGAGCCAATGAGCACCAGCAGAAACGAAACGAAAAACCACTACTACCTTTGGAAAAT
TATAGGGAGAATAACTTCCTGAACA
GenBank Accession ED598570 [GenBank]
Graphic View Graphic view of gene At5g63630
Predicted Position of Insertion Chr5:25474740 - go to primer design
BLAST e Value 1e-10
Hit Clone Code (BAC ID) MBK5
Hit Gene Code At5g63630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37