DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_090646c
Line Availability available from NASC (N679973) and ABRC (SALK_090646c)
Confirmed for Hit At5g14120
Parent of DUPLO pair none
Parent of pair(s) 2563, 96214, 96216

Gene hit At5g14120

 
Sequence (A. th genome BLAST matches underlined)
AAAATGCTTTCTGGGTTTCCTTTGTTTCTTCTCTCCGCCCCCGGGAGAATGCTGG
GenBank Accession ED598849 [GenBank]
Graphic View Graphic view of gene At5g14120
Predicted Position of Insertion Chr5:4556302 - go to primer design
BLAST e Value 3e-19
Hit Clone Code (BAC ID) MUA22
Hit Gene Code At5g14120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37