DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_093125 |
Line Availability | available from NASC (N593125) and ABRC (SALK_093125) |
Confirmed for Hit | At5g17540 |
Parent of DUPLO pair | 2755 |
Parent of pair(s) | none |
Gene hit At5g17540
Sequence (A. th genome BLAST matches underlined) | AAATGCTAACGTCTTTCTTATGGGGGTATCGCACC |
GenBank Accession | ED599172 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:5782659 - go to primer design |
BLAST e Value | 1e-07 |
Hit Clone Code (BAC ID) | K10A8 |
Hit Gene Code | At5g17540 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | HXXXD-type acyl-transferase family protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |