DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_093125
Line Availability available from NASC (N593125) and ABRC (SALK_093125)
Confirmed for Hit At5g17540
Parent of DUPLO pair 2755
Parent of pair(s) none

Gene hit At5g17540

 
Sequence (A. th genome BLAST matches underlined)
AAATGCTAACGTCTTTCTTATGGGGGTATCGCACC
GenBank Accession ED599172 [GenBank]
Graphic View Graphic view of gene At5g17540
Predicted Position of Insertion Chr5:5782659 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) K10A8
Hit Gene Code At5g17540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation HXXXD-type acyl-transferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37