DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_093369
Line Availability available from NASC (N593369) and ABRC (SALK_093369)
Confirmed for Hit At4g25390
Parent of DUPLO pair none
Parent of pair(s) 3218, 3332

Gene hit At4g25390

 
Sequence (A. th genome BLAST matches underlined) 
AAAATCAGCGATTTTGGCAGAGAAGAGACTATCTAATAGAACATTGCTAGGCTTAATATC
ACCATGAATCACAGGTGGTTCAAGACTATGAAGATGCTTAATCCCATCGGCAATGTTAAC
GGCAACCAAAAACCTCCGATTCCAATCCATAAGCTCAGGGCATCTCCGGTGAAGCAAGGC
GTCTTGGAGATTACCATTGTCCATAAGCT
GenBank Accession ED599293 [GenBank]
Graphic View Graphic view of gene At4g25390
Predicted Position of Insertion Chr4:12978222 - go to primer design
BLAST e Value 1e-115
Hit Clone Code (BAC ID) T30C3
Hit Gene Code At4g25390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37