DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_093560
Line Availability available from NASC (N593560) and ABRC (SALK_093560)
Confirmed for Hit At1g25400
Parent of DUPLO pair none
Parent of pair(s) 521

Gene hit At1g25400

 
Sequence (A. th genome BLAST matches underlined)
CGCCGATGACAATAACGAGTATGAGCCGCATTTGCTGATAAAAGAAGCCACCGGACTTCC
TTCTCCGCTGGAATCCAAATTGTCCCTAAGCT
GenBank Accession ED599429 [GenBank]
Graphic View Graphic view of gene At1g25400
Predicted Position of Insertion Chr1:8911751 - go to primer design
BLAST e Value 2e-31
Hit Clone Code (BAC ID) F2J7
Hit Gene Code At1g25400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37