DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_096772c
Line Availability available from NASC (N682688) and ABRC (SALK_096772c)
Confirmed for Hit At4g35360
Parent of DUPLO pair none
Parent of pair(s) 712, 81891

Gene hit At4g35360

 
Sequence (A. th genome BLAST matches underlined) 
CTTCGAAGATGACCAAGTCTGCATCGCTTGAGAGGTACGCAACCTCCGGCGATACTCTTG
CGAGATCATAACCTGCGCACTAGATAGAAAGGATAAGAAATTTTTTACGGGAATTAGTGA
TAACTTGGAGTTCCATCTTCTTGTGCGAGCTGGTGAGTAACATACCG
GenBank Accession ED601089 [GenBank]
Graphic View Graphic view of gene At4g35360
Predicted Position of Insertion Chr4:16812636 - go to primer design
BLAST e Value 3e-50
Hit Clone Code (BAC ID) F23E12
Hit Gene Code At4g35360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation pantothenate kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37