DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_098534c
Line Availability available from NASC (N660051) and ABRC (SALK_098534c)
Confirmed for Hit At3g60840
Parent of DUPLO pair 2512
Parent of pair(s) none

Gene hit At3g60840

 
Sequence (A. th genome BLAST matches underlined)
GGAGGAGAAACTCCCAACTTTCTGGTCCTATCAGATCACTGAACTTTCCGGTTGCAGGAA
AAGCTGCGAGATCTCCAACGTCTTAAGAATTCTCTTTCAGCTGTCACTTCCAATATCTTG
AATT
GenBank Accession ED601832 [GenBank]
Graphic View Graphic view of gene At3g60840
Predicted Position of Insertion Chr3:22477916 - go to primer design
BLAST e Value 6e-29
Hit Clone Code (BAC ID) T4C21
Hit Gene Code At3g60840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation microtubule-associated protein 65-4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37