DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_099193c
Line Availability available from NASC (N659047) and ABRC (SALK_099193c)
Confirmed for Hit At4g10230
Parent of DUPLO pair 11737
Parent of pair(s) none

Gene hit At4g10230

 
Sequence (A. th genome BLAST matches underlined)
TCATGTTGGTTTGTTTGTGCTCTTTTTTCCAAAATTCTTTTTCTCTCATTTTCAACATAT
GCACCAGAGGATGGATCACTTATAAAATT
GenBank Accession BZ596980 [GenBank]
Graphic View Graphic view of gene At4g10230
Predicted Position of Insertion Chr4:6366995 - go to primer design
BLAST e Value 3e-39
Hit Clone Code (BAC ID) F24G24
Hit Gene Code At4g10230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation no-apical-meristem-associated carboxy-terminal domain protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37