DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_102165c
Line Availability available from NASC (N663505) and ABRC (SALK_102165c)
Confirmed for Hit At5g15140
Parent of DUPLO pair 12710
Parent of pair(s) none

Gene hit At5g15140

 
Sequence (A. th genome BLAST matches underlined) 
GGAAATTTGGGATGGTTCAATGCGTCTGGATAACTTTGTGTGTCTAAACATAATCCCCCG
AAAGCT
GenBank Accession BH903157 [GenBank]
Graphic View Graphic view of gene At5g15140
Predicted Position of Insertion Chr5:4910600 - go to primer design
BLAST e Value 4e-28
Hit Clone Code (BAC ID) F8M21
Hit Gene Code At5g15140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose mutarotase-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBankBH903157 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37