DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_103601c
Line Availability available from NASC (N655133) and ABRC (SALK_103601c)
Confirmed for Hit At3g50720
Parent of DUPLO pair none
Parent of pair(s) 2692, 68944

Gene hit At3g50720

 
Sequence (A. th genome BLAST matches underlined)
TCATAAGCTTCATCTTCGGTGATCGTTATCTCATTATTACTTCTCTCTGAGCAGAATCTT
TTTAGCAAGCTTTCCAGTGAGATTGTAATATCTTTGAATT
GenBank Accession BH903880 [GenBank]
Graphic View Graphic view of gene At3g50720
Predicted Position of Insertion Chr3:18847658 - go to primer design
BLAST e Value 1e-50
Hit Clone Code (BAC ID) T3A5
Hit Gene Code At3g50720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37