DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_105118c
Line Availability available from NASC (N661065) and ABRC (SALK_105118c)
Confirmed for Hit At2g04350
Parent of DUPLO pair 2662
Parent of pair(s) none

Gene hit At2g04350

 
Sequence (A. th genome BLAST matches underlined)
TTCTGAGAATCCAATGACGATTTCATGTCGATGAGAAGGGCACAAGGTGGTTTTACACCG
GAGATATTGGGAGATTCCACCCTGATGGATGTCTCGAAGTCATCGATAGAAAGAAAGATA
TTGTTAAACTTCAACATGGGGAATACCTATCCCTTGGAAAGGTTTGCCTATAGAACTTAA
ATTCTACATAGAGGATGGTGG
GenBank Accession BH904791 [GenBank]
Graphic View Graphic view of gene At2g04350
Predicted Position of Insertion Chr2:1518467 - go to primer design
BLAST e Value 4e-99
Hit Clone Code (BAC ID) T23O15
Hit Gene Code At2g04350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AMP-dependent synthetase and ligase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37