DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_105822c |
| Line Availability | available from NASC (N666953) and ABRC (SALK_105822c) |
| Confirmed for Hit | At5g38110 |
| Parent of DUPLO pair | 507 |
| Parent of pair(s) | none |
Gene hit At5g38110
| Sequence (A. th genome BLAST matches underlined) | TTGGTTTTGCTACAGATTTGGAATGG |
| GenBank Accession | BH905263 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:15209410 - go to primer design |
| BLAST e Value | 3e-07 |
| Hit Clone Code (BAC ID) | F16F17 |
| Hit Gene Code | At5g38110 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | anti- silencing function 1b |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 