DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_105847
Line Availability available from NASC (N605847) and ABRC (SALK_105847)
Parent of DUPLO pair 2807
Parent of pair(s) none

Gene hit At5g14040

 
Sequence (A. th genome BLAST matches underlined)
AGTGAGATCGGGAATCAAACATCGCCTCCGTCTCTCATTTCAAACGCTATCTCCATCTCC
TTCCTCCGCCGCCGCCATGGAATCTCCGAAGAATT
GenBank Accession BH905279 [GenBank]
Graphic View Graphic view of gene At5g14040
Predicted Position of Insertion Chr5:4533041 - go to primer design
BLAST e Value 1e-47
Hit Clone Code (BAC ID) MAC12
Hit Gene Code At5g14040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phosphate transporter 3;1
Insertion Classification TS2TE (5')
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37