DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_106046c
Line Availability available from NASC (N660075) and ABRC (SALK_106046c)
Confirmed for Hit At5g09740
Parent of DUPLO pair 2212
Parent of pair(s) none

Gene hit At5g09740

 
Sequence (A. th genome BLAST matches underlined)
GCAATGAGCAGAGATTTATGTCTGTGGTTTCTAGGTAACAAGCT
GenBank Accession BZ377701 [GenBank]
Graphic View Graphic view of gene At5g09740
Predicted Position of Insertion Chr5:3023902 - go to primer design
BLAST e Value 1e-17
Hit Clone Code (BAC ID) F17I14
Hit Gene Code At5g09740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone acetyltransferase of the MYST family 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BZ377701 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37