DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_106917
Line Availability available from NASC (N606917) and ABRC (SALK_106917)
Parent of DUPLO pair 12302
Parent of pair(s) none

Gene hit At3g61550

 
Sequence (A. th genome BLAST matches underlined)
TACATATGTTGCGGCGCCTCACGCCTCCGCTTCTCTGCCTCCGCCGCAAACGCAAACGCA
AACGCATCGTT
GenBank Accession BH905546 [GenBank]
Graphic View Graphic view of gene At3g61550
Predicted Position of Insertion Chr3:22776585 - go to primer design
BLAST e Value 1e-28
Hit Clone Code (BAC ID) F2A19
Hit Gene Code At3g61550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37