DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_107689c
Line Availability available from NASC (N653758) and ABRC (SALK_107689c)
Confirmed for Hit At1g72670
Parent of DUPLO pair 3134
Parent of pair(s) none

Gene hit At1g72670

 
Sequence (A. th genome BLAST matches underlined)
TAACATCTGATTGCAATTCTAATAGAAAGTTAGAAACTTAAATCAACCATCAACACTTAA
TGGATCATTAAACTAAGTCAATTCATTTGAGCAGCTCATTTGTTGTCTTCTCTGAAGCT
GenBank Accession BH905741 [GenBank]
Graphic View Graphic view of gene At1g72670
Predicted Position of Insertion Chr1:27358152 - go to primer design
BLAST e Value 8e-62
Hit Clone Code (BAC ID) F28P22
Hit Gene Code At1g72670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation IQ-domain 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37