DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_107941c
Line Availability available from NASC (N653423) and ABRC (SALK_107941c)
Confirmed for Hit At2g45470
Parent of DUPLO pair none
Parent of pair(s) 2640

Gene hit At2g45470

 
Sequence (A. th genome BLAST matches underlined)
GTTTATACTCAGCGAGGGCGTGATACTCTAAGAGCGAGACTACCTCAGCTTGTGTGAGCT
TCGTCAGATCTGGTACACCTTCAGCTTTAAAAGCT
GenBank Accession BZ378326 [GenBank]
Graphic View Graphic view of gene At2g45470
Predicted Position of Insertion Chr2:18743273 - go to primer design
BLAST e Value 1e-47
Hit Clone Code (BAC ID) F4L23
Hit Gene Code At2g45470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FASCICLIN-like arabinogalactan protein 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37