DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_109389
Line Availability available from NASC (N609389) and ABRC (SALK_109389)
Confirmed for Hit At1g08830
Parent of DUPLO pair 2808
Parent of pair(s) none

Gene hit At1g08830

 
Sequence (A. th genome BLAST matches underlined)
ATGATGGTATGCCTTCTCAACATTTGTATCCCTCATCTCAAGCT
GenBank Accession BH906176 [GenBank]
Graphic View Graphic view of gene At1g08830
Predicted Position of Insertion Chr1:2828196 - go to primer design
BLAST e Value 1e-17
Hit Clone Code (BAC ID) F22O13
Hit Gene Code At1g08830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation copper/zinc superoxide dismutase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED603313 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37