DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_114391c
Line Availability available from NASC (N676570) and ABRC (SALK_114391c)
Confirmed for Hit At4g01000
Parent of DUPLO pair 12013
Parent of pair(s) none

Gene hit At4g01000

 
Sequence (A. th genome BLAST matches underlined)
CTCGTCGTCGCTATCATCACTGTCACTATCTTCAACAGCTCTCTTCCCCTTCCTATAAAA
ACCAACACATCATCAACGACAAGAAACATACATATGAAGAACTCAAGTAACAAAATTAGC
ATCACAATTTCAGAAAAAAATAACAACTTTAACAATCAATCAAGTAAAGAGAATT
GenBank Accession BZ379964 [GenBank]
Graphic View Graphic view of gene At4g01000
Predicted Position of Insertion Chr4:432925 - go to primer design
BLAST e Value 2e-82
Hit Clone Code (BAC ID) F3I3
Hit Gene Code At4g01000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ubiquitin-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37