DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_114435
Line Availability available from NASC (N614435) and ABRC (SALK_114435)
Confirmed for Hit At1g47470
Parent of DUPLO pair none
Parent of pair(s) 77270, 77279, 77287, 77294, 77301, 77302, 77303, 77304, 77305, 77306

Gene hit At1g47470

 
Sequence (A. th genome BLAST matches underlined)
TCCTGGAGAATCTCCATTCGAAGAATCTGATTCACCCGCAATGGAATATGATAGGGAGCT
TGCTCACCGTTACTCGCATAAACAGCTCGATTTTCTTGAGGCTTGCTCTTACAAGGCAAT
CTCGAGATGCAGAAATGATGGTCTCAACATCGTGTTATATGAGACAGTGC
GenBank Accession BZ379994 [GenBank]
Graphic View Graphic view of gene At1g47470
Predicted Position of Insertion Chr1:17414977 - go to primer design
BLAST e Value 4e-49
Hit Clone Code (BAC ID) F16N3
Hit Gene Code At1g47470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ECA1 gametogenesis family protein (DUF784)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37