DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_114735
Line Availability available from NASC (N614735) and ABRC (SALK_114735)
Confirmed for Hit At2g24000
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g24000

 
Sequence (A. th genome BLAST matches underlined)
ATCTGTATCACCACTGCATGGAGAAATAGTGATTTCATGACCAAAATATGTGTTGC
GenBank Accession BZ380178 [GenBank]
Graphic View Graphic view of gene At2g24000
Predicted Position of Insertion Chr2:10213802 - go to primer design
BLAST e Value 2e-17
Hit Clone Code (BAC ID) T29E15
Hit Gene Code At2g24000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation serine carboxypeptidase-like 22
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37